pPGK-GZF1-RR
(Plasmid #35092)

• Depositing Lab: David Segal
• Publication: Bhakta et al Methods Mol Biol. 2010;649:3-30.

Backbone

• Vector backbone: pPGK
• Backbone size w/o insert (bp): 4500
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZFN GZF1-Fok(RR)
• Species: synthetic
• Insert Size (bp): 1000
• Mutation: contains the "RR" obligate heterodimer variant
• Promoter: PGK
• Tags / Fusion Proteins:
  • HA (N terminal on insert)
  • SV40 NLS (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: HAtag-f: ATGTACCCATACGATGTCCCAGACTACG
• 3′ sequencing primer: FokLinkSeq-r: TCTATCCTGAGTGGAATTTCTGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Originally described in Szczepek, M., Brondani, V., Büchel, J., Serrano, L., Segal, D.J. and Cathomen, T. (2007) Structure-based redesign of the dimerization interface reduces the toxicity of zinc finger nucleases. Nat. Biotechnol., 25:786-793.