pSSA-1-3
(Plasmid #35091)

• Depositing Lab: David Segal
• Publication: Bhakta et al Methods Mol Biol. 2010;649:3-30.

Backbone

• Vector backbone: pGL3-control
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5256
• Modifications to backbone: Luciferase gene is split into two inactive fragments containing overlapping homologies with a ZFN site between them. In cells, cleavage at the ZFN site will initiate single strand annealing and generate an active luciferase gene.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Split luciferase for GZF1/3 SSA assay
• Alt name: Firefly luciferase
• Insert Size (bp): 906
• Mutation: Single strand annealing (SSA) recombinaion reporter assay containing target site for GZF1/3 zinc finger nuclease
• Promoter: SV40

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: LucRep-f: CGAAGGTTGTGGATCTGGATACC
• 3′ sequencing primer: LucRep-r: TAGCTGATGTAGTCTCAGTGAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Originally described in Szczepek, M., Brondani, V., Büchel, J., Serrano, L., Segal, D.J. and Cathomen, T. (2007) Structure-based redesign of the dimerization interface reduces the toxicity of zinc finger nucleases. Nat. Biotechnol., 25:786-793.