Lmx1b
(Plasmid #34997)

• Depositing Lab: Malin Parmar
• Publication: Pfisterer et al Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6.

Backbone

• Vector backbone: pCCL-cppt-PGK-WPRE
• Backbone manufacturer: Malin Parmar
• Backbone size w/o insert (bp): 7041
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LIM homeobox transcription factor 1-beta
• Alt name: Lmx1b
• Species: M. musculus (mouse)
• Insert Size (bp): 1119
• GenBank ID: NT_039206.7
• Entrez Gene: Lmx1b (a.k.a. Icst, LMX1.1, LMX1.2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GACGGGAAAGACCCGAGAA
• 3′ sequencing primer: GAAAGCTCTTCGCTGCTGTGT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry