-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepaavCAG
- Backbone size w/o insert (bp) 5000
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepresynaptic mGRASP
-
Alt namepre-mGRASP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1722
-
GenBank IDJN898961
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gcggctctagagcctctgcta
- 3′ sequencing primer ttaaagcagcgtatccacat (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
paavCAG-pre-mGRASP-mCerulean-2A-nls-mCherry was a gift from Jinhyun Kim (Addgene plasmid # 34911 ; http://n2t.net/addgene:34911 ; RRID:Addgene_34911) -
For your References section:
mGRASP enables mapping mammalian synaptic connectivity with light microscopy. Kim J, Zhao T, Petralia RS, Yu Y, Peng H, Myers E, Magee JC. Nat Methods. 2011 Dec 4;9(1):96-102. doi: 10.1038/nmeth.1784. 10.1038/nmeth.1784 PubMed 22138823