-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 34885 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-VSV-G
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSindbis virus envelope protein
-
SpeciesSindbus Virus
-
Insert Size (bp)3800
-
MutationSGN UTR in E1 domain
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer pCMV-VSV-G-Fwd: AACCGGGCCCCTCTGCTAAC
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
2.2 expresses the mutated version of the Sinbis virus envelope protein (also referred to as m168), in addition to the SGN UTR mutations (AK226-227SG in E1 domain). This mutant reduces residual tropism while maintaining a high titer on targeted cells.
This plasmid was created using Addgene Plasmid pCMV-VSV-G (#8454), where the VSV-G was removed and replaced with the Sindbis virus envelope protein (above).
See map for construction details and recommended restriction digest analysis.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2.2 was a gift from Irvin Chen (Addgene plasmid # 34885 ; http://n2t.net/addgene:34885 ; RRID:Addgene_34885) -
For your References section:
A novel dual-targeted lentiviral vector leads to specific transduction of prostate cancer bone metastases in vivo after systemic administration. Pariente N, Morizono K, Virk MS, Petrigliano FA, Reiter RE, Lieberman JR, Chen IS. Mol Ther. 2007 Nov;15(11):1973-81. Epub 2007 Jul 24. 10.1038/sj.mt.6300271 PubMed 17653099