2.2
(Plasmid #34885)

• Depositing Lab: Irvin Chen
• Publication: Pariente et al Mol Ther. 2007 Nov;15(11):1973-81. Epub 2007 Jul 24.

Backbone

• Vector backbone: pCMV-VSV-G
• Backbone size w/o insert (bp): 5000
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sindbis virus envelope protein
• Species: Sindbus Virus
• Insert Size (bp): 3800
• Mutation: SGN UTR in E1 domain
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: None (unknown if destroyed)
• 3′ cloning site: None (unknown if destroyed)
• 5′ sequencing primer: pCMV-VSV-G-Fwd: AACCGGGCCCCTCTGCTAAC

Resource Information

• Addgene Notes:
  • Transient low pH treatment enhances infection of lentiviral vector pseudotypes with a targeting Sindbis envelope
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

2.2 expresses the mutated version of the Sinbis virus envelope protein (also referred to as m168), in addition to the SGN UTR mutations (AK226-227SG in E1 domain). This mutant reduces residual tropism while maintaining a high titer on targeted cells.

This plasmid was created using Addgene Plasmid pCMV-VSV-G (#8454), where the VSV-G was removed and replaced with the Sindbis virus envelope protein (above).

See map for construction details and recommended restriction digest analysis.