-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSB100X transposase
-
Insert Size (bp)1023
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site ApaI (unknown if destroyed)
- 5′ sequencing primer CACCAAAATCAACGGGACTT (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byProf. Dr. Zsuzsanna Izsvak, Max-Delbrueck-Center for Molecular Medicine, Berlin
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Sleeping Beauty transposon system consists of two components: the transposon vector and the transposase vector. The transposon vector (pT4/HB, Addgene #108352) contains binding sites flanking the GOI. And the transposase vector (pCMV(CAT)T7-SB100, Addgene #34879) encodes for the enzyme mediating excision and integration of the GOI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV(CAT)T7-SB100 was a gift from Zsuzsanna Izsvak (Addgene plasmid # 34879) -
For your References section:
Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Mates L, Chuah MK, Belay E, Jerchow B, Manoj N, Acosta-Sanchez A, Grzela DP, Schmitt A, Becker K, Matrai J, Ma L, Samara-Kuko E, Gysemans C, Pryputniewicz D, Miskey C, Fletcher B, VandenDriessche T, Ivics Z, Izsvak Z. Nat Genet. 2009 Jun;41(6):753-61. Epub 2009 May 3. 10.1038/ng.343 PubMed 19412179