Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYFJ16-LplA(W37V) (for E. Coli expression)
(Plasmid #34838)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34838 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pYFJ16
  • Backbone manufacturer
    Gift from John Cronan
  • Backbone size w/o insert (bp) 4800
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LplA W37V
  • Alt name
    coumarin ligase
  • Alt name
    coumarin PRIME ligase
  • Species
    E. Coli
  • Insert Size (bp)
    1014
  • Mutation
    Mutated Trp37 to Val
  • Entrez Gene
    lplA (a.k.a. b4386, ECK4378, JW4349, slr, yjjF)
  • Promoter T5 promoter
  • Tag / Fusion Protein
    • His Tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer GAATTCATTAAAGAGGAG
  • 3′ sequencing primer CTTTCTCTTCGATTTGCCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Received original LplA plasmid from John Cronan (currently at UI-UC)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYFJ16-LplA(W37V) (for E. Coli expression) was a gift from Alice Ting (Addgene plasmid # 34838 ; http://n2t.net/addgene:34838 ; RRID:Addgene_34838)
  • For your References section:

    A fluorophore ligase for site-specific protein labeling inside living cells. Uttamapinant C, White KA, Baruah H, Thompson S, Fernandez-Suarez M, Puthenveetil S, Ting AY. Proc Natl Acad Sci U S A. 2010 Jun 15. 107(24):10914-9. 10.1073/pnas.0914067107 PubMed 20534555