Skip to main content
Addgene

pQTEV-CUTC
(Plasmid #34801)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34801 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pQTEV
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Rosetta
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    cutC copper transporter homolog (E. coli)
  • Alt name
    CGI-32
  • Alt name
    PSFEp758J211
  • Species
    H. sapiens (human)
  • GenBank ID
    DQ000505
  • Entrez Gene
    CUTC (a.k.a. CGI-32)
  • Tags / Fusion Proteins
    • His (N terminal on backbone)
    • Strep (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.

Please note that there is a small gap between Addgene's quality control sequence and the reference sequence provided by the depositor. The gap is downstream of the ORF and should not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQTEV-CUTC was a gift from Konrad Buessow (Addgene plasmid # 34801 ; http://n2t.net/addgene:34801 ; RRID:Addgene_34801)

  • For your References section:

    Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5. 4():21. 10.1186/1475-2859-4-21 PubMed 15998469
Related items: