-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34678 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDsRed-Monomer-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFoxO1-RFP
-
Alt nameFoxo1
-
Alt nameFkhr
-
Alt nameforkhead box O1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1960
-
Entrez GeneFoxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- RFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer DsRed1-N (GTACTGGAACTGGGGGGACAG); SV40pA-R (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Has L619P polymorphism
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdsRED-Mono-N1-FoxO1 was a gift from Domenico Accili (Addgene plasmid # 34678 ; http://n2t.net/addgene:34678 ; RRID:Addgene_34678)