pBAD-mTagBFP2
(Plasmid #34632)

• Depositing Lab: Vladislav Verkhusha
• Publication: Subach et al PLoS One. 2011;6(12):e28674. Epub 2011 Dec 8.

Backbone

• Vector backbone: pBAD
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mTagBFP2
• Insert Size (bp): 738
• Mutation: I174A compared to mTagBFP (enhanced photostability and chromophore chemical stability)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: 5' atgccatagcatttttatcc 3'
• 3′ sequencing primer: 5' GAT TTA ATC TGT ATC AGG CTG 3'

Resource Information

• Articles Citing this Plasmid:
  • 19 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry