peGFP(N1)-deltaCMV-rSyntaxin1a-meGFP
(Plasmid #34631)

• Depositing Lab: Wolfhard Almers
• Publication: Barg et al Proc Natl Acad Sci U S A. 2010 Nov 30;107(48):20804-9. Epub 2010 Nov 12.

Backbone

• Vector backbone: peGFP(N1)
• Backbone manufacturer: clontech
• Backbone size w/o insert (bp): 4733
• Modifications to backbone: CMV promoter is partially deleted.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rat Syntaxin1a
• Alt name: rSYX1a
• Species: R. norvegicus (rat)
• Insert Size (bp): 863
• GenBank ID: NM_053788
• Entrez Gene: Stx1a
• Promoter: cmv
• Tag / Fusion Protein:
  • meGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: AgeI (unknown if destroyed)
• 5′ sequencing primer: tgggaggtctatataagcag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Delta CMV promoter was cut out from Delta CMV-GFP-Vinculin (waterman lab) with Ase1 and Nhe1to replace CMV promoter in syntaxin 1a GFP in same sites
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry