Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

peGFP(N1)-deltaCMV-rSyntaxin1a-meGFP
(Plasmid #34631)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34631 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    peGFP(N1)
  • Backbone manufacturer
    clontech
  • Backbone size w/o insert (bp) 4733
  • Modifications to backbone
    CMV promoter is partially deleted.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rat Syntaxin1a
  • Alt name
    rSYX1a
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    863
  • GenBank ID
    NM_053788
  • Entrez Gene
    Stx1a
  • Promoter cmv
  • Tag / Fusion Protein
    • meGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer tgggaggtctatataagcag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Delta CMV promoter was cut out from Delta CMV-GFP-Vinculin (waterman lab) with Ase1 and Nhe1to replace CMV promoter in syntaxin 1a GFP in same sites
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    peGFP(N1)-deltaCMV-rSyntaxin1a-meGFP was a gift from Wolfhard Almers (Addgene plasmid # 34631 ; http://n2t.net/addgene:34631 ; RRID:Addgene_34631)
  • For your References section:

    Single secretory granules of live cells recruit syntaxin-1 and synaptosomal associated protein 25 (SNAP-25) in large copy numbers. Barg S, Knowles MK, Chen X, Midorikawa M, Almers W. Proc Natl Acad Sci U S A. 2010 Nov 30;107(48):20804-9. Epub 2010 Nov 12. 10.1073/pnas.1014840107 PubMed 21076040