-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 33308 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonecFUGW
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSV-TK/GFP
-
Insert Size (bp)2000
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site none (destroyed during cloning)
- 3′ cloning site none (destroyed during cloning)
- 5′ sequencing primer EF1a fwd primer
- 3′ sequencing primer CTGGTCTAACCAGAGAGACC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cEF.tk-GFP was a gift from Linzhao Cheng (Addgene plasmid # 33308 ; http://n2t.net/addgene:33308 ; RRID:Addgene_33308) -
For your References section:
Serial imaging of human embryonic stem-cell engraftment and teratoma formation in live mouse models. Pomper MG, Hammond H, Yu X, Ye Z, Foss CA, Lin DD, Fox JJ, Cheng L. Cell Res. 2009 Mar;19(3):370-9. 10.1038/cr.2008.329 PubMed 19114988