-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 33307 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonecFUGW
-
Backbone manufacturerDavid Baltimore
-
Vector typeMammalian Expression, Lentiviral, Luciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
Alt namefLuc
-
Speciesfirefly
-
Insert Size (bp)1652
- Promoter Ubc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaactatgcgctcggggttgg
- 3′ sequencing primer agaagacagggccaggtttcc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ubc.Luc.IRES.Puro was a gift from Linzhao Cheng (Addgene plasmid # 33307 ; http://n2t.net/addgene:33307 ; RRID:Addgene_33307) -
For your References section:
Molecular imaging and stem cell research. Jang YY, Ye Z, Cheng L. Mol Imaging. 2011 Apr;10(2):111-22. PubMed 21439256