Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLG-Sty
(Plasmid #33149)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 33149 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLGSD5
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    TG1
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RP51A-synthetic minimal intron
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    Sty1 site upstream of intron was cut/filled/ligated to change CCATGG to CCATGCATGG
  • Entrez Gene
    RPS17A (a.k.a. YML024W, RP51A, RPL51A)
  • Tag / Fusion Protein
    • LacZ (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer LacZ-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLG-Sty was a gift from Michael Rosbash (Addgene plasmid # 33149 ; http://n2t.net/addgene:33149 ; RRID:Addgene_33149)
  • For your References section:

    Some cis- and trans-acting mutants for splicing target pre-mRNA to the cytoplasm. Legrain P, Rosbash M. Cell. 1989 May 19;57(4):573-83. 10.1016/0092-8674(89)90127-X PubMed 2655924