pLG-PLint
(Plasmid
#33145)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 33145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLGSD5
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)TG1
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRP51A-synthetic minimal intron
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneRPS17A (a.k.a. YML024W, RP51A, RPL51A)
-
Tag
/ Fusion Protein
- LacZ (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer none
- 3′ sequencing primer LacZ-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The PLint sequence was derived from the short version (delta2) of the RP51A intron (Pikielny et al., 1983). The basic strategy was to make a short intron of about 60 nucleotides, keeping as much as possible of the sequence near the consensus sequences, and adding convenient restriction sites.
Inserted sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLG-PLint was a gift from Michael Rosbash (Addgene plasmid # 33145 ; http://n2t.net/addgene:33145 ; RRID:Addgene_33145) -
For your References section:
Some cis- and trans-acting mutants for splicing target pre-mRNA to the cytoplasm. Legrain P, Rosbash M. Cell. 1989 May 19;57(4):573-83. 10.1016/0092-8674(89)90127-X PubMed 2655924