pMSCV-puro-Flag-mMcl-1 KR
(Plasmid
#32983)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32983 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepMSCVpuro
- Backbone size w/o insert (bp) 6295
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMcl-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1025
-
MutationAll Lys to Arg
-
Entrez GeneMcl1 (a.k.a. Gm52627, Mcl-1)
- Promoter LTR
-
Tag
/ Fusion Protein
- 3XFlag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-puro-Flag-mMcl-1 KR was a gift from Joseph Opferman (Addgene plasmid # 32983 ; http://n2t.net/addgene:32983 ; RRID:Addgene_32983) -
For your References section:
Ubiquitin-independent degradation of antiapoptotic MCL-1. Stewart DP, Koss B, Bathina M, Perciavalle RM, Bisanz K, Opferman JT. Mol Cell Biol. 2010 Jun;30(12):3099-110. Epub 2010 Apr 12. 10.1128/MCB.01266-09 PubMed 20385764