Skip to main content

p3XFlag-CMV10-Flag-mMcl-1 KR
(Plasmid #32979)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32979 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p3XFlag-CMV10
  • Backbone manufacturer
    Sigma
  • Backbone size w/o insert (bp) 6307
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mcl-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    995
  • Mutation
    All lys changed to Arg
  • Entrez Gene
    Mcl1 (a.k.a. Gm52627, Mcl-1)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3XFlag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaattaaccatggactacaa
  • 3′ sequencing primer ccaggagaggcactggggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3XFlag-CMV10-Flag-mMcl-1 KR was a gift from Joseph Opferman (Addgene plasmid # 32979 ; http://n2t.net/addgene:32979 ; RRID:Addgene_32979)
  • For your References section:

    Ubiquitin-independent degradation of antiapoptotic MCL-1. Stewart DP, Koss B, Bathina M, Perciavalle RM, Bisanz K, Opferman JT. Mol Cell Biol. 2010 Jun;30(12):3099-110. Epub 2010 Apr 12. 10.1128/MCB.01266-09 PubMed 20385764