p3XFlag-CMV10-Flag-mMcl-1
(Plasmid #32978)

• Depositing Lab: Joseph Opferman
• Publication: Stewart et al Mol Cell Biol. 2010 Jun;30(12):3099-110. Epub 2010 Apr 12.

Backbone

• Vector backbone: p3XFlag-CMV10
• Backbone manufacturer: Sigma
• Backbone size w/o insert (bp): 6307
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mcl-1
• Species: M. musculus (mouse)
• Insert Size (bp): 995
• Entrez Gene: Mcl1 (a.k.a. Gm52627, Mcl-1)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3XFlag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: acaaagaccatgacggtgat
• 3′ sequencing primer: ccaggagaggcactggggag

Resource Information

• Supplemental Documents:
  • Vector NTI file
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry