pEntr-SRFflbio
(Plasmid #32971)

• Depositing Lab: William Pu
• Publication: He et al Proc Natl Acad Sci U S A. 2011 Apr 5. 108(14):5632-7.

Backbone

• Vector backbone: pEntr3c
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2700
• Modifications to backbone: see pEntr-flbio
• Vector type: gateway

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SRF
• Species: H. sapiens (human)
• Insert Size (bp): 1500
• Entrez Gene: SRF (a.k.a. MCM1)
• Tag / Fusion Protein:
  • flag-bio (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: GGCATCAAACTAAGCAGAAG
• 3′ sequencing primer: GTAACATCAGAGATTTTGAGACAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry