CYP7A1 (3SN5)
(Plasmid
#32874)
-
PurposeBacterial expression for structure determination; may not be full ORF
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCW-LIC
-
Backbone manufacturerStructural Genomics Consortium (Addgene plasmid 26098)
- Backbone size w/o insert (bp) 6980
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCYP7A1
-
Alt namePDB: 3SN5
-
Alt nameName: Human cytochrome P450, family 7, subfamily A, polypeptide 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1473
-
Mutationamino acids 25-503 only
-
Entrez GeneCYP7A1 (a.k.a. CP7A, CYP7, CYPVII)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pCW-SEQ-fwd (ACATCGTATAACGTTACTGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PDB: 3SN5. http://www.thesgc.org/structures/3SN5/
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CYP7A1 (3SN5) was a gift from Cheryl Arrowsmith (Addgene plasmid # 32874 ; http://n2t.net/addgene:32874 ; RRID:Addgene_32874)