EGFP-talin1 head
(Plasmid #32856)

• Depositing Lab: Anna Huttenlocher
• Publication: Simonson et al J Immunol. 2006 Dec 1;177(11):7707-14.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: BD Clontech
• Backbone size w/o insert (bp): 4749
• Modifications to backbone: C1 vector frame shifted by cutting with BglII, blunting, and religating.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Talin-1 Head aa 1-433
• Species: M. musculus (mouse)
• Insert Size (bp): 1299
• GenBank ID: X56123 CAA39588.1
• Entrez Gene: Tln1 (a.k.a. Tln)
• Tag / Fusion Protein:
  • Enhanced GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: Sal1 (not destroyed)
• 5′ sequencing primer: EGFP_C_prime CATGGTCCTGCTGGAGTTCGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: EGFP-talin1 head was cloned by excising the talin1 head cDNA (encoding aa 1–433) by EcoRI/SalI digestion from the pJ6 R vector (a gift from R. Hynes, Massachusetts Institute of Technology, Cambridge, MA)
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the most appropriate reference sequence for the Talin1 insert in this plasmid is GenBank accession number CAA39588.1