Addgene: EGFP-talin1 head Skip to main content
Addgene

EGFP-talin1 head
(Plasmid #32856)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32856 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    BD Clontech
  • Backbone size w/o insert (bp) 4749
  • Modifications to backbone
    C1 vector frame shifted by cutting with BglII, blunting, and religating.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Talin-1 Head aa 1-433
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1299
  • GenBank ID
    X56123 CAA39588.1
  • Entrez Gene
    Tln1 (a.k.a. Tln)
  • Tag / Fusion Protein
    • Enhanced GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Sal1 (not destroyed)
  • 5′ sequencing primer EGFP_C_prime CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    EGFP-talin1 head was cloned by excising the talin1 head cDNA (encoding aa 1–433) by EcoRI/SalI digestion from the pJ6 R vector (a gift from R. Hynes, Massachusetts Institute of Technology, Cambridge, MA)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the most appropriate reference sequence for the Talin1 insert in this plasmid is GenBank accession number CAA39588.1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-talin1 head was a gift from Anna Huttenlocher (Addgene plasmid # 32856 ; http://n2t.net/addgene:32856 ; RRID:Addgene_32856)
  • For your References section:

    Talin1 regulates TCR-mediated LFA-1 function. Simonson WT, Franco SJ, Huttenlocher A. J Immunol. 2006 Dec 1;177(11):7707-14. PubMed 17114441