pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE
(Plasmid #32702)

• Purpose: Conditional overexpression vector. Deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and the activation of your gene fused to eGFP expression.
• Depositing Lab: Hans Clevers
• Publication: Koo et al Nat Methods. 2011 Dec 4. doi: 10.1038/nmeth.1802.

Backbone

• Vector backbone: MSCV
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6295
• Modifications to backbone: loxp-dsRed-loxp-MCS-eGFP seq is inserted.
• Vector type: Mammalian Expression, Retroviral, Cre/Lox
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: The depositor notes that XL1-Blue is also ok for general purpose use.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: eGFP
• Insert Size (bp): 720

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CTCCCACAACGAGGACTACAC

Resource Information

• Supplemental Documents:
  • In fusion cloning in pMSCV-loxp-dsRed-loxp vectors
• Articles Citing this Plasmid:
  • 21 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry