Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-TDAG51
(Plasmid #32699)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32699 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human tdag51
  • Alt name
    phlda1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    792
  • GenBank ID
    GenBank: AAH18929.3
  • Entrez Gene
    PHLDA1 (a.k.a. DT1P1B11, PHRIP, TDAG51)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer 5'd[CATGGTCCTGCTGGAGTTCGTG]
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-TDAG51 was a gift from Richard C. Austin (Addgene plasmid # 32699 ; http://n2t.net/addgene:32699 ; RRID:Addgene_32699)
  • For your References section:

    TDAG51 is induced by homocysteine, promotes detachment-mediated programmed cell death, and contributes to the cevelopment of atherosclerosis in hyperhomocysteinemia. Hossain GS, van Thienen JV, Werstuck GH, Zhou J, Sood SK, Dickhout JG, de Koning AB, Tang D, Wu D, Falk E, Poddar R, Jacobsen DW, Zhang K, Kaufman RJ, Austin RC. J Biol Chem. 2003 Aug 8;278(32):30317-27. Epub 2003 May 8. 10.1074/jbc.M212897200 PubMed 12738777