pTfR-PAmKate
(Plasmid #32692)

• Depositing Lab: Vladislav Verkhusha
• Publication: Gunewardene et al Biophys J. 2011 Sep 21;101(6):1522-8. Epub 2011 Sep 20.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6299
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PAmKate
• Alt name: photoactivatable dark-to-far red fluorescent protein
• Insert Size (bp): 715
• Mutation: F84W/S148N/S165G compared to mKate (but numbering relative to EGFP).
• Promoter: CMV
• Tag / Fusion Protein:
  • transferrin receptor (TfR) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: cggtaggcgtgtacggtgggag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry