Tcf/Lef:H2B-GFP
(Plasmid #32610)

• Depositing Lab: Anna-Katerina Hadjantonakis
• Publication: Ferrer-Vaquer et al BMC Dev Biol. 2010 Dec 21;10:121.

Backbone

• Vector backbone: pEGFP-N1
• Backbone size w/o insert (bp): 4700
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tcf/Lef:H2B-GFP
• Promoter: hsp68

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AseI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: GF PGenotFW: A CAACAAGCGCTCGACCATCAC;
• 3′ sequencing primer: GFPGenotRW: AGTCGATGCCCTTCAGCTCGAT

Resource Information

• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To g ene r a t e t h e p T CF /L e f :H 2 B -GFP co n s t ru c t , s i x
copies of the TCF/Lef response elements together with
the hsp68 minimal promoter from the TCF/Lef-LacZ
reporter construct [11] were inserted into the AseI/Nhe1
sites of pCMV::H2B-GFP.