pENTR-L3-HCN1miR-EGFP-L2
(Plasmid #32585)

• Depositing Lab: Matthew Nolan
• Publication: White et al Front Mol Neurosci. 2011;4:8. Epub 2011 Jul 4.

Backbone

• Vector backbone: pDONR221 P3-P2
• Backbone manufacturer: Invitrogen
• Vector type: Gateway cloning vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Intronic HCN1miRNA and EGFP

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: M13 Forward

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The HCN1miR was cloned into pSM155-GFP provided by Guangwei Du, University of Texas Health Science Center, Houston. A cassette containing the intronic miRNA upstream of EGFP was then amplified with PCR primers containing att sites and recombined to generate the entry vector.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HCN1miRNA sequence TAAAGACGACAGTAGGTATCAGT

Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.