Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTYF-3.6TPH-GAL4p65
(Plasmid #32571)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32571 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTYF
  • Backbone size w/o insert (bp) 7469
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gal4p65
  • Species
    M. musculus (mouse), S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1062
  • Promoter 3.6TPH

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer atgaagctactgtcttctatcgaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTYF-3.6TPH-GAL4p65 was a gift from Sergey Kasparov (Addgene plasmid # 32571 ; http://n2t.net/addgene:32571 ; RRID:Addgene_32571)
  • For your References section:

    Targeting central serotonergic neurons with lentiviral vectors based on a transcriptional amplification strategy. Benzekhroufa K, Liu BH, Teschemacher AG, Kasparov S. Gene Ther. 2009 May;16(5):681-8. Epub 2009 Feb 12. 10.1038/gt.2009.7 PubMed 19212426