Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

punc-119cbr
(Plasmid #32568)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32568 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    punc-119c
  • Backbone size w/o insert (bp) 1413
  • Vector type
    Worm Expression
  • Selectable markers
    unc-119 (C. briggsae)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    unc-119
  • Alt name
    Cbr-unc-119
  • Species
    C. briggsae
  • Insert Size (bp)
    2155
  • GenBank ID
    U45326.1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    C. briggsae unc-119 gene was PCR amplified from pCFJ151.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid is similar to punc-119c but has C. briggsae unc-119 genomic DNA in place of C. elegans unc-119 promoter and cDNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    punc-119cbr was a gift from Al Fisher (Addgene plasmid # 32568 ; http://n2t.net/addgene:32568 ; RRID:Addgene_32568)
  • For your References section:

    Improved vectors for selection of transgenic Caenorhabditis elegans. Ferguson AA, Cai L, Kashyap L, Fisher AL. Methods Mol Biol. 2013;940:87-102. doi: 10.1007/978-1-62703-110-3_8. 10.1007/978-1-62703-110-3_8 PubMed 23104336
Commonly requested with: