punc-119cbr
(Plasmid #32568)

• Depositing Lab: Al Fisher
• Publication: Ferguson et al Methods Mol Biol. 2013;940:87-102. doi: 10.1007/978-1-62703-110-3_8.

Backbone

• Vector backbone: punc-119c
• Backbone size w/o insert (bp): 1413
• Vector type: Worm Expression
• Selectable markers: unc-119 (C. briggsae)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: unc-119
• Alt name: Cbr-unc-119
• Species: C. briggsae
• Insert Size (bp): 2155
• GenBank ID: U45326.1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GTAACATCAGAGATTTTGAGACAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: C. briggsae unc-119 gene was PCR amplified from pCFJ151.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid is similar to punc-119c but has C. briggsae unc-119 genomic DNA in place of C. elegans unc-119 promoter and cDNA.