EGFP-Bak
(Plasmid #32564)

• Depositing Lab: Richard Youle
• Publication: Nechushtan et al J Cell Biol. 2001 Jun 11. 153(6):1265-76.

Backbone

• Vector backbone: pEGFP-C3
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4727
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Bak
• Alt name: bCL2-antagonist/killer 1
• Alt name: BCL2L7
• Alt name: BAK1
• Species: H. sapiens (human)
• Insert Size (bp): 636
• GenBank ID: NM_001188
• Entrez Gene: BAK1 (a.k.a. BAK, BAK-LIKE, BCL2L7, CDN1)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (not destroyed)
• 3′ cloning site: Kpn I (not destroyed)
• 5′ sequencing primer: AGAAGCGCGATCACATGG
• 3′ sequencing primer: CTACAAATGTGGTATGGCTG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry