pUCBB-pBAD-eGFP
(Plasmid #32553)

• Depositing Lab: Claudia Schmidt-dannert
• Publication: Vick et al Appl Microbiol Biotechnol. 2011 Dec;92(6):1275-86. Epub 2011 Oct 28.

Backbone

• Vector backbone: pUCBB
• Backbone manufacturer: Schmidt-Dannert Lab
• Backbone size w/o insert (bp): 3488
• Modifications to backbone: Biobrick section contains the araC gene to control expression from the pBAD promoter. It will move with the BioBrick.
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP
• Insert Size (bp): 719
• Entrez Gene: eGFP (a.k.a. pPRS3a_01)
• Promoter: pBAD
• Tag / Fusion Protein:
  • His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: not designed
• 3′ sequencing primer: pBBinR (GCAGGTCCTGAAGTTAACTAG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry