Skip to main content
Addgene

Cyclin D1 shRNA-B
(Plasmid #32494)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32494 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMKO.1
  • Backbone size w/o insert (bp) 6700
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cyclin D1
  • gRNA/shRNA sequence
    CCACAGATGTGAAGTTCATTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    CCND1 (a.k.a. BCL1, D11S287E, PRAD1, U21B31)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer pLXSN 5'
  • 3′ sequencing primer none
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cyclin D1 shRNA-B was a gift from Peter Sicinski (Addgene plasmid # 32494 ; http://n2t.net/addgene:32494 ; RRID:Addgene_32494)

  • For your References section:

    A function for cyclin D1 in DNA repair uncovered by protein interactome analyses in human cancers. Jirawatnotai S, Hu Y, Michowski W, Elias JE, Becks L, Bienvenu F, Zagozdzon A, Goswami T, Wang YE, Clark AB, Kunkel TA, van Harn T, Xia B, Correll M, Quackenbush J, Livingston DM, Gygi SP, Sicinski P. Nature. 2011 Jun 8;474(7350):230-4. doi: 10.1038/nature10155. 10.1038/nature10155 PubMed 21654808
Related items:
Commonly requested with: