pEGFP-ATXN1-52Q
(Plasmid #32492)

• Depositing Lab: Huda Zoghbi
• Publication: Cummings et al Nat Genet. 1998 Jun;19(2):148-54.

Backbone

• Vector backbone: pEGFP-C1
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ataxin-1
• Alt name: ATXN1
• Species: H. sapiens (human)
• Insert Size (bp): 2604
• Mutation: insert contains a stretch of 52 Glutamines and no stop codon
• GenBank ID: NM_000332
• Entrez Gene: ATXN1 (a.k.a. ATX1, D6S504E, SCA1)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry