Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CMV-FFluc-GPD1L-3'UTR Seed Mut
(Plasmid #32490)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32490 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5400
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPD1L 3'UTR
  • Alt name
    GPD1L
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Gpd1l (a.k.a. 2210409H23Rik, D9Ertd660e)
  • Promoter CMV
  • Tag / Fusion Protein
    • Luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer Luc-F
  • 3′ sequencing primer BGHrev
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Seed mutant sequence - GTCGACCTCAGTGAATGCGTGTC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-FFluc-GPD1L-3'UTR Seed Mut was a gift from Pere Puigserver (Addgene plasmid # 32490 ; http://n2t.net/addgene:32490 ; RRID:Addgene_32490)
  • For your References section:

    A hypoxia-induced positive feedback loop promotes hypoxia-inducible factor 1alpha stability through miR-210 suppression of glycerol-3-phosphate dehydrogenase 1-like. Kelly TJ, Souza AL, Clish CB, Puigserver P. Mol Cell Biol. 2011 Jul;31(13):2696-706. Epub 2011 May 9. 10.1128/MCB.01242-10 PubMed 21555452