CMV-FFluc-GPD1L-3'UTR Seed Mut
(Plasmid
#32490)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32490 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5400
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPD1L 3'UTR
-
Alt nameGPD1L
-
SpeciesM. musculus (mouse)
-
Entrez GeneGpd1l (a.k.a. 2210409H23Rik, D9Ertd660e)
- Promoter CMV
-
Tag
/ Fusion Protein
- Luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer Luc-F
- 3′ sequencing primer BGHrev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Seed mutant sequence - GTCGACCTCAGTGAATGCGTGTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-FFluc-GPD1L-3'UTR Seed Mut was a gift from Pere Puigserver (Addgene plasmid # 32490 ; http://n2t.net/addgene:32490 ; RRID:Addgene_32490) -
For your References section:
A hypoxia-induced positive feedback loop promotes hypoxia-inducible factor 1alpha stability through miR-210 suppression of glycerol-3-phosphate dehydrogenase 1-like. Kelly TJ, Souza AL, Clish CB, Puigserver P. Mol Cell Biol. 2011 Jul;31(13):2696-706. Epub 2011 May 9. 10.1128/MCB.01242-10 PubMed 21555452