rAAV-CAG::FLEX-rev:ChR2HA:2a:PSAML141F,Y115F:GlyR
(Plasmid #32483)

• Depositing Lab: Scott Sternson
• Publication: Magnus et al Science. 2011 Sep 2;333(6047):1292-6.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 5000
• Modifications to backbone: WPRE (Woodchuck hepatitis virus posttranscriptional regulatory element) before polyA sequence
• Vector type: AAV, Cre/Lox ; Adeno-associated virus, FLEX switch

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ChR2HA-2a-PSAML141F,Y115F:GlyR
• Species: H. sapiens (human); Chlamydomonas reinhardtii
• Insert Size (bp): 2346
• Promoter: CAG
• Tag / Fusion Protein:
  • ChR2 2A (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI blunt (destroyed during cloning)
• 3′ cloning site: SpeI blunt (destroyed during cloning)
• 5′ sequencing primer: ctgtggctgcgtgaaagccttg
• 3′ sequencing primer: gagttgtggcccgttgtcag

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note on handling these rAAV constructs:
These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence.