rAAV-syn::FLEX-rev::PSAML141F,Y115F:GlyR-IRES-GFP
(Plasmid #32481)

• Depositing Lab: Scott Sternson
• Publication: Magnus et al Science. 2011 Sep 2;333(6047):1292-6.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 5100
• Vector type: AAV, Cre/Lox ; Adeno-associated virus, FLEX switch

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PSAML141F,Y115F-GlyR
• Species: H. sapiens (human)
• Insert Size (bp): 2643
• Promoter: Synapsin
• Tag / Fusion Protein:
  • IRES-EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: speI blunt (destroyed during cloning)
• 3′ cloning site: SpeI blunt (destroyed during cloning)
• 5′ sequencing primer: gtaagtatcaaggttacaag
• 3′ sequencing primer: ctgacaacgggccacaactc

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Comments:
These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence.

In Magnus et al, the PSAMY115F,L141F-GlyR channel was emphasized for silencing because this channel has the lowest acetylcholine responsiveness. However, PSAML141F-GlyR constructs, lacking the Y115F mutation, already have low ACh potency. The Y115F mutation also slightly increases the EC50 for the activator ligand, PSEM89S. Since PSAML141F-GlyR constructs already have very low acetylcholine potency, in many cases it may not be worth the slight reduction in PSEM potency. We have made both constructs available for researchers who may find that they have different requirements with respect to acetylcholine responsiveness.