CMV-B-GECO1
(Plasmid #32448)

• Purpose: Mammalian expression of blue fluorescent genetically encoded Ca2+ indicator for optical imaging
• Depositing Lab: Robert Campbell
• Publication: Zhao et al Science. 2011 Sep 8.

Backbone

• Vector backbone: Customized Vector
• Backbone size w/o insert (bp): 3200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: B-GECO1.0
• Alt name: blue intensiometric genetically encoded Ca2+-indicators for optical imaging
• Insert Size (bp): 1257
• Mutation: GCaMP3 S40P/L60P/D86G/K119I/L173Q/T223S/Y224H/D305G/R377P/K380Q/ S404G
• GenBank ID: JN258412
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Could not make stable cell line using this vector.

There is 1bp mismatch between Addgene's quality control sequence and the provided depositor's sequence, P5S in protein sequence. This mutation should not affect the protein function and the depositing lab confirmed that in vivo experiment before.