CMV-G-GECO1.0
(Plasmid #32447)

• Purpose: Mammalian expression of green fluorescent genetically encoded Ca2+ indicator for optical imaging (version 1.0)
• Depositing Lab: Robert Campbell
• Publication: Zhao et al Science. 2011 Sep 8.

Backbone

• Vector backbone: Customized Vector
• Backbone size w/o insert (bp): 3200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: G-GECO1.0
• Alt name: green intensiometric genetically encoded Ca2+-indicators for optical imaging version 1.0
• Insert Size (bp): 1251
• Mutation: GCaMP3 K119I/L173Q/S404G/E430V
• GenBank ID: JN258413

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Could not make stable cell line using this vector.