Skip to main content
Addgene

CMV-R-GECO1
(Plasmid #32444)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32444 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3200
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    R-GECO1.0
  • Alt name
    red intensiometric genetically encoded Ca2+-indicators for optical imaging
  • Species
    synthetic construct
  • Insert Size (bp)
    1254
  • Mutation
    Substitutions relative to the mApple-derived analogue of GCaMP3: T47A/L60P/E61V/S63V/E64S/R81G/K83R/Y134C/M158L/N164aD/V228A/ S290P/I366F/K380N/S404G/N414D/E430V
  • GenBank ID
    JN258411
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Could not make stable cell line using this vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-R-GECO1 was a gift from Robert Campbell (Addgene plasmid # 32444 ; http://n2t.net/addgene:32444 ; RRID:Addgene_32444)

  • For your References section:

    An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao Y, Araki S, Wu J, Teramoto T, Chang YF, Nakano M, Abdelfattah AS, Fujiwara M, Ishihara T, Nagai T, Campbell RE. Science. 2011 Sep 8. 10.1126/science.1208592 PubMed 21903779
Related items:
Commonly requested with: