CMV-GEM-GECO1
(Plasmid #32442)

• Purpose: Mammalian expression of blue-green emission ratiometric genetically encoded Ca2+ indicator for optical imaging
• Depositing Lab: Robert Campbell
• Publication: Zhao et al Science. 2011 Sep 8.

Backbone

• Vector backbone: Customized Vector
• Backbone size w/o insert (bp): 3200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GEM-GECO1
• Alt name: emission ratiometric genetically encoded Ca2+-indicators for optical imaging
• Species: synthetic construct
• Insert Size (bp): 1248
• Mutation: GCaMP3 L60P/K69E/N77Y/D86G/N98I/K119I/L173Q/T223S/N302S/R377P/K380Q/S404G/E430V
• GenBank ID: JN258409
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Could not make stable cell line using this vector.

Addgene's sequencing result identified a single nucleotide mismatch at position 1182 when compared to the sequence provided by the depositing scientist and GenBank ID JN258409. According to the depositing scientist, this mismatch does not affect the protein sequence and is not a concern for the function of the plasmid.