-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32385 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePeredox-mCherry-NLS
-
Insert Size (bp)2800
-
Tag
/ Fusion Protein
- Nuclear Localization Seq (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-Peredox-mCherry-NLS was a gift from Gary Yellen (Addgene plasmid # 32385 ; http://n2t.net/addgene:32385 ; RRID:Addgene_32385) -
For your References section:
Imaging Cytosolic NADH-NAD(+) Redox State with a Genetically Encoded Fluorescent Biosensor. Hung YP, Albeck JG, Tantama M, Yellen G. Cell Metab. 2011 Oct 5;14(4):545-54. 10.1016/j.cmet.2011.08.012 PubMed 21982714