pGL3Basic-Mdm2-T3
(Plasmid
#32369)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32369 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMdm2 promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)430
-
Entrez GeneMdm2 (a.k.a. 1700007J15Rik, Mdm-2)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3Basic-Mdm2-T3 was a gift from Hong Wu (Addgene plasmid # 32369 ; http://n2t.net/addgene:32369 ; RRID:Addgene_32369) -
For your References section:
PTEN regulates Mdm2 expression through the P1 promoter. Chang CJ, Freeman DJ, Wu H. J Biol Chem. 2004 Jul 9;279(28):29841-8. Epub 2004 Apr 16. 10.1074/jbc.M401488200 PubMed 15090541