Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL3Basic-miR126-EGFL7-Promoter
(Plasmid #32244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32244 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL3Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR-126 Promoter 5' UTR
  • Alt name
    EGFL7 Promoter 5' UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1770
  • Mutation
    Promoter region 5' UTR
  • Entrez Gene
    MIR126 (a.k.a. MIRN126, miRNA126, mir-126)
  • Entrez Gene
    EGFL7 (a.k.a. NEU1, VE-STATIN, ZNEU1)
  • Promoter 5' UTR

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCCTGCTGCCAACTTGTTCT
  • 3′ sequencing primer ATGGACCCTAGCCCTTGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3Basic-miR126-EGFL7-Promoter was a gift from Charles Lowenstein (Addgene plasmid # 32244 ; http://n2t.net/addgene:32244 ; RRID:Addgene_32244)
  • For your References section:

    Ets-1 and Ets-2 regulate the expression of microRNA-126 in endothelial cells. Harris TA, Yamakuchi M, Kondo M, Oettgen P, Lowenstein CJ. Arterioscler Thromb Vasc Biol. 2010 Oct;30(10):1990-7. Epub 2010 Jul 29. 10.1161/ATVBAHA.110.211706 PubMed 20671229