Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENTR/U6 HDAC5 shRNA
(Plasmid #32222)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32222 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENTR/U6
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2854
  • Vector type
    RNAi ; Gateway U6 ENTRY Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA against mouse HDAC5
  • gRNA/shRNA sequence
    GGCTCAGACAGGTGAGAAAGACGAATCTTTCTCACCTGTCTGAGCC
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001077696
  • Entrez Gene
    Hdac5 (a.k.a. HD5, Hdac4, mHDA1, mKIAA0600)
  • Promoter human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer M13for-20
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR/U6 HDAC5 shRNA was a gift from Reuben Shaw (Addgene plasmid # 32222 ; http://n2t.net/addgene:32222 ; RRID:Addgene_32222)
  • For your References section:

    Class IIa histone deacetylases are hormone-activated regulators of FOXO and mammalian glucose homeostasis. Mihaylova MM, Vasquez DS, Ravnskjaer K, Denechaud PD, Yu RT, Alvarez JG, Downes M, Evans RM, Montminy M, Shaw RJ. Cell. 2011 May 13;145(4):607-21. 10.1016/j.cell.2011.03.043 PubMed 21565617