Skip to main content
Addgene

pJFRC150-20XUAS-IVS-Flp1::PEST
(Plasmid #32132)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32132 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJFRC7-20XUAS-IVS-mCD8::GFP
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Flippase1::PEST
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    Aspartic Acid at Amino Acid 5
  • Tag / Fusion Protein
    • PEST (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
  • 3′ sequencing primer SV40 R: CCATTCATCAGTTCCATAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC150-20XUAS-IVS-Flp1::PEST was a gift from Gerald Rubin (Addgene plasmid # 32132 ; http://n2t.net/addgene:32132 ; RRID:Addgene_32132)
  • For your References section:

    Multiple new site-specific recombinases for use in manipulating animal genomes. Nern A, Pfeiffer BD, Svoboda K, Rubin GM. Proc Natl Acad Sci U S A. 2011 Aug 9. 10.1073/pnas.1111704108 PubMed 21831835