pJFRC150-20XUAS-IVS-Flp1::PEST
(Plasmid #32132)

• Depositing Lab: Gerald Rubin
• Publication: Nern et al Proc Natl Acad Sci U S A. 2011 Aug 9.

Backbone

• Vector backbone: pJFRC7-20XUAS-IVS-mCD8::GFP
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10/P3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Flippase1::PEST
• Species: S. cerevisiae (budding yeast)
• Mutation: Aspartic Acid at Amino Acid 5
• Tag / Fusion Protein:
  • PEST (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: hsp70 F: GAGCGCCGGAGTATAAATAGAG
• 3′ sequencing primer: SV40 R: CCATTCATCAGTTCCATAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry