pGPI-SceI
(Plasmid
#32060)
-
Purpose(Empty Backbone) Construction of unmarked gene deletions. Suicide cloning vector designed to introduce a targeted I-SceI restriction site in the genome of Burkholderia
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepGPI-oriR6K
-
Backbone manufacturerValvano
-
Vector typemutagenesis plasmid
-
Selectable markerstrimethoprim
Growth in Bacteria
-
Bacterial Resistance(s)Trimethoprim
-
Growth Temperature37°C
-
Growth Strain(s)Pir1 ; any strain containing lambda pir, Pir1
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TAACGGTTGTGGACAACAAGCCAGGG
- 3′ sequencing primer GCCCTACACAAATTGGGAGATATATC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGPI-SceI was a gift from Miguel Valvano (Addgene plasmid # 32060 ; http://n2t.net/addgene:32060 ; RRID:Addgene_32060) -
For your References section:
A system for the construction of targeted unmarked gene deletions in the genus Burkholderia. Flannagan RS, Linn T, Valvano MA. Environ Microbiol. 2008 Jun;10(6):1652-60. Epub 2008 Mar 13. 10.1111/j.1462-2920.2008.01576.x PubMed 18341581
Map uploaded by the depositor.
