mCherry-SEpHluorin
(Plasmid #32001)

• Depositing Lab: Sergio Grinstein
• Publication: Koivusalo et al J Cell Biol. 2010 Feb 22;188(4):547-63. Epub 2010 Feb 15.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Modifications to backbone: The EGFP coding region from the EGFP-N1 vector was replaced with a PCR product containing the SEpHluorin coding region flanked by BamHI and NotI restriction sites.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry
• Insert Size (bp): 902
• Tag / Fusion Protein:
  • Superecliptic pHluorin (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'

Resource Information

• Articles Citing this Plasmid:
  • 13 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry