LOVS1K
(Plasmid #31981)

• Purpose: Expresses a LOVS1K, a light-controllable synthetic protein to modulate local or global Ca2+ signaling
• Depositing Lab: Kevin Truong
• Publication: Pham et al Chem Biol. 2011 Jul 29;18(7):880-90.

Backbone

• Vector backbone: pTriEx 3
• Backbone size w/o insert (bp): 5000
• Vector type: Mammalian Expression, Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LOVS1K
• Species: H. sapiens (human); Avena sativa (oat)
• Insert Size (bp): 1100
• Promoter: CMV, p10
• Tag / Fusion Protein:
  • RFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: (TriEx UP) GTTATTGTGCTGTCTCATCA
• 3′ sequencing primer: T7 terminal

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloning primers:
5' end:
CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA
3' end:
CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG

LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao.