pEGFP-STAG2-D299A
(Plasmid #31975)

• Depositing Lab: Todd Waldman
• Publication: Solomon et al Science. 2011 Aug 19;333(6045):1039-43.

Backbone

• Vector backbone: pEGFP-C3
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4727
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human STAG2 cDNA
• Alt name: stromal antigen 2
• Alt name: SA-2
• Species: H. sapiens (human)
• Mutation: changed Aspartic acid 299 to Alanine
• Entrez Gene: STAG2 (a.k.a. SA-2, SA2, SCC3B, bA517O1.1)
• Tags / Fusion Proteins:
  • EGFP (N terminal on backbone)
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tgaagcagaacggaataaaatg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry