pEGFP-STAG2-wildtype
(Plasmid #31972)

• Depositing Lab: Todd Waldman
• Publication: Solomon et al Science. 2011 Aug 19;333(6045):1039-43.

Backbone

• Vector backbone: pEGFP-C3
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4727
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human STAG2 cDNA
• Alt name: stromal antigen 2
• Alt name: SA-2
• Species: H. sapiens (human)
• Mutation: wild-type
• Entrez Gene: STAG2 (a.k.a. SA-2, SA2, SCC3B, bA517O1.1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • EGFP (N terminal on backbone)
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GFP-Fwd [CATGGTCCTGCTGGAGTTCGTG]

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry